Estimation of SARS-CoV-2 infection fatality rate by real-time antibody

Screening of Blood Donors-

Profiling antibodies to SARS-CoV-2 can assist to evaluate potential immune response after COVID-19 illness. Luciferase IP system (LIPS) assay is a delicate methodology for quantitative detection of antibodies to antigens of their native conformation.

 

We right here describe LIPS to detect antibody responses to SARS-CoV-2 spike (S) and nucleocapsid (N) proteins in COVID-19 sufferers.

 

 

The antibodies focused each S and N fragments and gave a excessive assay sensitivity by figuring out 26 out of 26 COVID-19 sufferers with N antigen or with three protein fragments when mixed right into a single response.

 

The assay correlated nicely with ELISA methodology and was particular to COVID-19 as we noticed no reactivity amongst uninfected wholesome controls.

 

 

Our outcomes present that LIPS is a speedy and measurable methodology to display antibody responses in opposition to SARS-CoV-2 antigens.

 

 

Genscanner
Genscanner

 

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
RDR-ESAM-Hu-48Tests 48 Tests
EUR 544
Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
RDR-ESAM-Hu-96Tests 96 Tests
EUR 756
Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
RD-ESAM-Hu-48Tests 48 Tests
EUR 521
Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
RD-ESAM-Hu-96Tests 96 Tests
EUR 723
anti-ESAM
YF-PA21677 50 ug
EUR 363
Description: Mouse polyclonal to ESAM
anti-ESAM
YF-PA21678 100 ul
EUR 403
Description: Rabbit polyclonal to ESAM
anti-ESAM
YF-PA21679 100 ug
EUR 403
Description: Rabbit polyclonal to ESAM
anti- ESAM antibody
FNab02860 100µg
EUR 548.75
  • Immunogen: endothelial cell adhesion molecule
  • Uniprot ID: Q96AP7
  • Gene ID: 90952
  • Research Area: Immunology, Cardiovascular
Description: Antibody raised against ESAM
Anti-ESAM antibody
PAab02860 100 ug
EUR 386
Anti-ESAM antibody
STJ114102 100 µl
EUR 277
Anti-ESAM antibody
STJ192300 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ESAM
Anti-ESAM (1G8)
YF-MA19632 100 ug
EUR 363
Description: Mouse monoclonal to ESAM
Anti-ESAM (1E4)
YF-MA19633 100 ug
EUR 363
Description: Mouse monoclonal to ESAM
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
Esam/ Rat Esam ELISA Kit
ELI-20559r 96 Tests
EUR 886
ESAM antibody
70R-17149 50 ul
EUR 435
Description: Rabbit polyclonal ESAM antibody
ESAM Antibody
1-CSB-PA850258LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
ESAM Antibody
1-CSB-PA007818GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
ESAM siRNA
20-abx901776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ESAM siRNA
20-abx915678
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ESAM siRNA
20-abx915679
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ESAM ELISA KIT|Human
EF009449 96 Tests
EUR 689
Human ESAM shRNA Plasmid
20-abx963997
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ESAM ELISA KIT
ELI-32729h 96 Tests
EUR 824
ESAM Recombinant Protein (Human)
RP010933 100 ug Ask for price
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280
ESAM Polyclonal Antibody
27645-100ul 100ul
EUR 252
ESAM Polyclonal Antibody
27645-50ul 50ul
EUR 187
ESAM Rabbit pAb
A12210-100ul 100 ul
EUR 308
ESAM Rabbit pAb
A12210-200ul 200 ul
EUR 459
ESAM Rabbit pAb
A12210-20ul 20 ul
EUR 183
ESAM Rabbit pAb
A12210-50ul 50 ul
EUR 223
ESAM Polyclonal Antibody
ABP58502-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein
ESAM Polyclonal Antibody
ABP58502-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein
ESAM Polyclonal Antibody
ABP58502-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein
ESAM cloning plasmid
CSB-CL850258HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atgatttccctcccggggcccctggtgaccaacttgctgcggtttttgttcctggggctgagtgccctcgcgcccccctcgcgggcccagctgcaactgcacttgcccgccaaccggttgcaggcggtggagggaggggaagtggtgcttccagcgtggtacaccttgcacgggg
  • Show more
Description: A cloning plasmid for the ESAM gene.
ESAM Polyclonal Antibody
A55335 100 µg
EUR 570.55
Description: kits suitable for this type of research
ESAM Polyclonal Antibody
ES11142-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

 

LIPS methodology for the detection of SARS-CoV-2 antibodies to spike and nucleocapsid proteins

 

Background: The pandemic on account of extreme acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has large penalties for our societies.
Information of the seroprevalence of SARS-CoV-2 is required to precisely monitor the unfold of the epidemic and to calculate the an infection fatality charge (IFR). These measures could assist the authorities to make knowledgeable selections and modify the present societal interventions.
The target was to carry out nationwide real-time seroprevalence surveying amongst blood donors as a software to estimate earlier SARS-CoV-2 infections and the inhabitants primarily based IFR.
Strategies: Danish blood donors aged 17-69 years giving blood April 6 to Might Three had been examined for SARS-CoV-2 immunoglobulin M and G antibodies utilizing a business lateral move check.
Antibody standing was in contrast between geographical areas and an estimate of the IFR was calculated. The seroprevalence was adjusted for assay sensitivity and specificity taking the uncertainties of the check validation under consideration when reporting the 95% confidence intervals (CI).
Outcomes: The primary 20,640 blood donors had been examined and a mixed adjusted seroprevalence of 1.9% (CI: 0.8-2.3) was calculated. The seroprevalence differed throughout areas.
Utilizing accessible knowledge on fatalities and inhabitants numbers a mixed IFR in sufferers youthful than 70 is estimated at 89 per 100,000 (CI: 72-211) infections.
Conclusions: The IFR was estimated to be barely decrease than beforehand reported from different international locations not utilizing seroprevalence knowledge. The IFR is probably going a number of fold decrease than the present estimate.

Rhizopus arrhizus (R. arrhizus) Antibody

abx414359-025mg 0.25 mg
EUR 648
  • Shipped within 1 week.

Magnaporthe oryzae Scytalone dehydratase (SDH1)

1-CSB-EP348697MPM
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Magnaporthe oryzae Scytalone dehydratase(SDH1) expressed in E.coli

Native Aspergillus oryzae endo-Inulinase (food grade)

NATE-1246 1kg
EUR 270

Native Aspergillus oryzae exo-Inulinase (Food Grade)

NATE-1250 1kg
EUR 270

Rabbit Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E04R0362-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E04R0362-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E04R0362-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E02R0362-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E02R0362-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E02R0362-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E03R0362-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E03R0362-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E03R0362-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E01R0362-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E01R0362-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E01R0362-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E06R0362-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E06R0362-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E06R0362-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E08R0362-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E08R0362-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E08R0362-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E09R0362-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E09R0362-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E09R0362-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E07R0362-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E07R0362-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E07R0362-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E05R0362-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E05R0362-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Rhizopus arrhizu Fatty Acid Desaturases 6 ELISA kit

E05R0362-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Rhizopus arrhizu Fatty Acid Desaturases 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Aspergillus Oryzae ACT1 Protein (aa 1-375) [His]

VAng-Wyb3947-1mg 1 mg
EUR 4702
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Actin, recombinant protein.

Recombinant Aspergillus Oryzae ADH5 Protein (aa 1-383) [His]

VAng-Wyb3948-1mg 1 mg
EUR 4730
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Alcohol Dehydrogenase 5 (Class III), chi Polypeptide, recombinant protein.

Recombinant Aspergillus Oryzae Amy3 Protein (aa 22-499) [His]

VAng-Wyb3949-1mg 1 mg
EUR 5109
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) alpha-Amylase A Type-3, recombinant protein.

Recombinant Aspergillus Oryzae AO090103000074 Protein (aa 19-316) [His]

VAng-Wyb3950-1mg 1 mg
EUR 4397
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Tannase, recombinant protein.

Recombinant Aspergillus Oryzae ATG12 Protein (aa 1-176) [His]

VAng-Wyb3951-1mg 1 mg
EUR 3916
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Autophagy Related 12, recombinant protein.

Recombinant Aspergillus Oryzae ATG3 Protein (aa 1-356) [His]

VAng-Wyb3952-1mg 1 mg
EUR 4625
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Autophagy Related 3 Homolog, recombinant protein.

Recombinant Aspergillus Oryzae ATG5 Protein (aa 1-322) [His]

VAng-Wyb3953-1mg 1 mg
EUR 4494
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Autophagy Related 5 Homolog, recombinant protein.

Recombinant Aspergillus Oryzae BCP1 Protein (aa 1-290) [His]

VAng-Wyb3954-1mg 1 mg
EUR 4364
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Bcp1p, recombinant protein.

Recombinant Aspergillus Oryzae BUD32 Protein (aa 1-272) [His]

VAng-Wyb3955-1mg 1 mg
EUR 4292
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Bud32p, recombinant protein.

Recombinant Aspergillus Oryzae CAP1 Protein (aa 1-273) [His]

VAng-Wyb3956-1mg 1 mg
EUR 4298
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Cap1p, recombinant protein.

Recombinant Aspergillus Oryzae CBP4 Protein (aa 1-116) [His]

VAng-Wyb3958-1mg 1 mg
EUR 3677
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Cbp4p, recombinant protein.

Recombinant Aspergillus Oryzae CFD1 Protein (aa 1-315) [His]

VAng-Wyb3959-1mg 1 mg
EUR 4466
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Cfd1p, recombinant protein.

Recombinant Aspergillus Oryzae CHZ1 Protein (aa 1-110) [His]

VAng-Wyb3960-1mg 1 mg
EUR 3655
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Chz1p, recombinant protein.

Recombinant Aspergillus Oryzae CTU2 Protein (aa 1-361) [His]

VAng-Wyb3962-1mg 1 mg
EUR 4645
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Cytosolic Thiouridylase Subunit 2 Homolog, recombinant protein.

Recombinant Aspergillus Oryzae DDI1 Protein (aa 1-402) [His]

VAng-Wyb3963-1mg 1 mg
EUR 4807
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) DNA-Damage Inducible 1 Homolog 1, recombinant protein.

Recombinant Aspergillus Oryzae DML1 Protein (aa 1-493) [His]

VAng-Wyb3964-1mg 1 mg
EUR 5166
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Dml1p, recombinant protein.

Recombinant Aspergillus Oryzae DOT1L Protein (aa 1-335) [His]

VAng-Wyb3965-1mg 1 mg
EUR 4540
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) DOT1-Like, Histone H3 Methyltransferase, recombinant protein.

Recombinant Aspergillus Oryzae DRE2 Protein (aa 1-313) [His]

VAng-Wyb3966-1mg 1 mg
EUR 4455
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Dre2p, recombinant protein.

Recombinant Aspergillus Oryzae EFG1 Protein (aa 1-320) [His]

VAng-Wyb3967-1mg 1 mg
EUR 4482
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Efg1p, recombinant protein.

Recombinant Aspergillus Oryzae Egd2 Protein (aa 1-202) [His]

VAng-Wyb3968-1mg 1 mg
EUR 4017
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Nascent Polypeptide-Associated Complex Subunit alpha, recombinant protein.

Recombinant Aspergillus Oryzae EIF3E Protein (aa 1-451) [His]

VAng-Wyb3969-1mg 1 mg
EUR 4999
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Eukaryotic Translation Initiation Factor 3 Subunit E, recombinant protein.

Recombinant Aspergillus Oryzae EIF3G Protein (aa 1-287) [His]

VAng-Wyb3970-1mg 1 mg
EUR 4350
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Eukaryotic Translation Initiation Factor 3, Subunit G, recombinant protein.

Recombinant Aspergillus Oryzae EIF3I Protein (aa 1-335) [His]

VAng-Wyb3971-1mg 1 mg
EUR 4540
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Eukaryotic Translation Initiation Factor 3, Subunit I, recombinant protein.

Recombinant Aspergillus Oryzae ESF2 Protein (aa 1-335) [His]

VAng-Wyb3972-1mg 1 mg
EUR 4540
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Esf2p, recombinant protein.

Recombinant Aspergillus Oryzae FIS1 Protein (aa 1-126) [His]

VAng-Wyb3973-1mg 1 mg
EUR 3716
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Fis1p, recombinant protein.

Recombinant Aspergillus Oryzae FPR1 Protein (aa 1-116) [His]

VAng-Wyb3974-1mg 1 mg
EUR 3677
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Fpr1p, recombinant protein.

Recombinant Aspergillus Oryzae FPR2 Protein (aa 20-134) [His]

VAng-Wyb3975-1mg 1 mg
EUR 3673
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Fpr2p, recombinant protein.

Recombinant Aspergillus Oryzae FPR4 Protein (aa 1-470) [His]

VAng-Wyb3976-1mg 1 mg
EUR 5076
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Fpr4p, recombinant protein.

Recombinant Aspergillus Oryzae GAPDH Protein (aa 1-338) [His]

VAng-Wyb3977-1mg 1 mg
EUR 4553
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Glyceraldehyde-3-Phosphate Dehydrogenase, recombinant protein.

We now have initiated real-time nationwide anti-SARS-CoV-2 seroprevalence surveying of blood donations as a software in monitoring the epidemic.

Serial Neuropsychological Testing in MOG Antibody-Related Illness To Enhance Understanding of Outcomes

 

Neurocognitive outcomes knowledge in sufferers with myelin oligodendrocyte glycoprotein (MOG) antibody-associated illness are restricted. Inside MOG-positive cohorts, outcomes knowledge usually make the most of gross psychological, cognitive, or bodily incapacity measures.

 

 

Right here, we report a pediatric affected person who offered with two clinically heterogeneous occasions and was discovered to have MOG-associated encephalomyelitis. We administered detailed neuropsychological check batteries to acquire a sturdy understanding of the affected person’s neurocognitive profile over time.

 

 

This case exemplifies the necessity to carry out systematic and serial neuropsychological testing in sufferers with MOG-associated illness to higher perceive neurocognitive outcomes, facilitate multidisciplinary administration, and enhance restoration.